meg3 sirna plasmids  (OriGene)

Journal: Stem Cell Research & Therapy

Article Title: Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines

doi: 10.1186/scrt535

Figure Lengend Snippet: Classification of MEG3 -ON and MEG3 -OFF human embryonic stem cells (hESCs) by detecting the expression of the DLK1-DIO3 locus-derived non-coding RNAs (ncRNAs). (A) The DLK1-DIO3 imprinted locus, which is highly conserved between mice and humans, including clusters of maternally expressed functional ncRNAs, which are marked in red. The human homologs of the Gtl2 and Rian mice genes are MEG3 and MEG8 , respectively. Lollipops with closed circles represent methylated CpG regions, and open circles represent unmethylated CpG regions. Mat, maternal chromosome; Pat, paternal chromosome. (B) The hESCs with high expression levels of imprinted long non-coding RNAs (lncRNAs) ( MEG3 and MEG8 ) and of several imprinted microRNAs (miRNAs) from the DLK1-DIO3 locus (miR-127-3p, miR-154, miR-376c, miR-495, miR-494, and miR-496) were classified as MEG3 -ON hESCs. The hESCs without detectable MEG3 expression accompanied by significant repression of other ncRNAs from the same locus were classified as MEG3 -OFF hESCs. GAPDH was used as an internal control for mRNA expression analysis, and RNU48 was used as an internal control for miRNA expression analysis. The quantitation of lncRNA and miRNA expression was performed by using the 2 −ΔΔCp method. Error bars represent the standard error of the mean generated from three biological repeats. ** P <0.01 with respective MEG3 -ON groups by Student’s t test. DLK1-DIO3 , delta-like homolog 1 gene and the type III iodothyronine deiodinase gene; Gtl2 , gene trap locus 2; IG-DMR, intergenic differentially methylated region; MEG3 , maternally expressed gene 3; N.D., not detectable.

Article Snippet: The MEG3 -siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNA-GFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNA-GFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3 -shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021).

Techniques: Expressing, Derivative Assay, Functional Assay, Methylation, Quantitation Assay, Generated

Journal: Stem Cell Research & Therapy

Article Title: Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines

doi: 10.1186/scrt535

Figure Lengend Snippet: Twelve - day-old embryoid bodies (EBs) differentiated from MEG3 -OFF human embryonic stem cells (hESCs) displayed abnormal morphologies and expression levels of developmentally regulated genes. (A) Day 12 EBs that were differentiated from MEG3 -OFF NTU1 hESCs were smaller and not well bordered in structure than EBs differentiated from MEG3 -ON NTU1 hESCs. Scale bars, 1,000 μm. The bar chart illustrated the differences in diameters of the 12-day-old EBs derived from MEG3 -ON and MEG3 -OFF hESC sublines. Error bars represent the standard error of the mean (SEM) generated from three biological samples with 20 to 40 EBs in each group. ** P <0.01 with respective MEG3 -ON groups by Student’s t test . (B) Day 12 EBs differentiated from MEG3 -OFF hESCs displayed unusual expression levels of developmentally regulated genes, including higher expression levels of endoderm- and mesoderm-related genes ( SOX17 and HAND1 , respectively) and low but detectable expression levels of an ectoderm-related gene ( PAX6 ). ‘d’ represents the day of EB formation. GAPDH was used as an internal control for mRNA expression analysis. The quantitation of mRNA expression was performed by using the 2 −ΔΔCp method. Error bars represent the SEM generated from three biological samples with three technical repeats each. ** P <0.01 compared with the corresponding MEG3 -ON groups by Student’s t test. MEG3 , maternally expressed gene 3.

Article Snippet: The MEG3 -siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNA-GFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNA-GFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3 -shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021).

Techniques: Expressing, Derivative Assay, Generated, Quantitation Assay

Journal: Stem Cell Research & Therapy

Article Title: Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines

doi: 10.1186/scrt535

Figure Lengend Snippet: MEG3 -OFF human embryonic stem cells (hESCs) displayed different transcriptome profiles, particularly in genes related to neural lineage. (A) In total, 114 genes displayed significant differential expression between MEG3 -ON and MEG3 -OFF hESCs. The embryoid body (EB) sample differentiated from ‘ MEG3 -ON’ hESCs was used as a reference for differentiated hESCs. The heatmap represents the most significant differentially expressed genes selected by the intersection indicated by Welch’s t test ( P <0.05; fold change >1.5) and significance analysis of microarrays (SAM) (false discovery rate <0.05). The heatmap displays differentially expressed genes that can be used to distinguish between the MEG3 -ON and MEG3 -OFF cell states. The green-to-red colors of the heatmap are linearly mapped to the Z-scores, which range from −3 to 3. (B) MEG3 -ON and MEG3 -OFF hESCs showed differences in the expression levels of many genes that correlate with neural lineage development and with different tumor types. This analysis was performed by using MetaCore software (GeneGo), which includes developmental processes 1,317 Gene Ontology (GO) terms in Biological Process for GO process testing and literature-based biomarkers of clinical diseases for GO disease testing. (C) A partial gene list of subset of genes related to ‘nervous system development (GO:0007399)’ was clearly shown to be differentially expressed between undifferentiated MEG3 -ON and MEG3 -OFF hESCs by using GSEA. In this heatmap, expression values are represented as colors, with the range of colors (red, pink, light blue, and dark blue) indicating the range of expression values (high, moderate, low, and lowest, respectively). MEG3 , maternally expressed gene 3.

Article Snippet: The MEG3 -siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNA-GFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNA-GFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3 -shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021).

Techniques: Expressing, Software

Journal: Stem Cell Research & Therapy

Article Title: Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines

doi: 10.1186/scrt535

Figure Lengend Snippet: Associations between the expression of MEG3 and neural lineage genes in human embryonic stem cell (hESC) and human induced pluripotent stem cell (hiPSC) lines. (A) Repression of MEG3 was consistently correlated with downregulation of PAX6 , RTN1 , and DLK1 in various cell lines. The cell lines where MEG3 was not detectable, including NTU1, NTU3, H9, and iPSC lines, also displayed lower expression levels of PAX6 , RTN1 , and DLK1 . The mRNA expression was quantified with the 2 −ΔΔCp method (using GAPDH for normalization). In the NTU1 and NTU3 hESC lines, error bars represent the standard error of the mean (SEM) generated from three biological repeats. In the H9 hESC line and the two iPSC lines, error bars represent the SEM generated from one biological sample with three technical repeats. * P <0.05, ** P <0.01 with the corresponding MEG3 -ON groups by Student’s t test . N.D., not detectable. (B) MEG3 knockdown assays were conducted via small hairpin RNA (shRNA) and small interfering RNA (siRNA) to examine the association between MEG3 reduction and the expression levels of neural lineage-related genes in NTU1 hESCs. In the sh- MEG3 group with MEG3 reduction, PAX6 , RTN1 , and DLK1 showed downregulated expression (upper panel) compared with the scramble control. PAX6 and RTN1 were also downregulated in two si- MEG3 -treated groups with reduced MEG3 expression, whereas DLK1 was reduced in one siRNA-treated group compared with the scramble control (lower panel). The mRNA expression was quantified with the 2 −ΔΔCp method (using GAPDH for normalization). Error bars represent the SEM generated from one biological sample with three technical repeats each. * P <0.05, ** P <0.01 with the corresponding scramble control groups by Student’s t test in shRNA experiments; one-way analysis of variance and Dunnett’s multiple comparisons test were used in siRNA experiments, with significance defined as * P <0.05 and ** P <0.01. MEG3 , maternally expressed gene 3.

Article Snippet: The MEG3 -siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNA-GFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNA-GFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3 -shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021).

Techniques: Expressing, Generated, shRNA, Small Interfering RNA

Journal: Stem Cell Research & Therapy

Article Title: Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines

doi: 10.1186/scrt535

Figure Lengend Snippet: Neural markers were differentially expressed between MEG3 -ON and MEG3 -OFF human embryonic stem cell (hESC)-differentiated cells during neural lineage differentiation. (A) Neural lineage differentiation was conducted from the undifferentiated stage to the 18 day-Matrigel attachment stage in NTU1 and NTU3 hESC lines. (B) Expression levels of stage-specific markers were analyzed by quantitative reverse transcription-polymerase chain reaction in MEG3 -ON and MEG3 -OFF groups during differentiation. The quantitation of mRNA expression was performed by using the 2 −ΔΔCp method (using the housekeeping gene GAPDH for normalization). Error bars represent the standard error of the mean generated from three biological samples with three technical repeats each. * P <0.05, ** P <0.01 compared with the respective MEG3 -ON groups by Student’s t test. MEG3 , maternally expressed gene 3; NES, neuroectodermal sphere.

Article Snippet: The MEG3 -siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNA-GFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNA-GFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3 -shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021).

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Quantitation Assay, Generated

Journal: Stem Cell Research & Therapy

Article Title: Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines

doi: 10.1186/scrt535

Figure Lengend Snippet: Neurite formation was reduced in MEG3 -OFF human embryonic stem cell (hESC)-differentiated cells compared with cells differentiated from MEG3 -ON hESCs. Immunofluorescent staining was performed with anti-beta-III Tubulin and anti-MAP2 antibodies to examine neurite formation in cells derived from MEG3 -ON and MEG3 -OFF hESCs of the NTU1 (A) and NTU3 (B) cell lines after 18 days of differentiation on Matrigel. Scale bars, 100 μm. MEG3 , maternally expressed gene 3.

Article Snippet: The MEG3 -siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNA-GFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNA-GFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3 -shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021).

Techniques: Staining, Derivative Assay

Journal: Stem Cell Research & Therapy

Article Title: Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines

doi: 10.1186/scrt535

Figure Lengend Snippet: Classification of MEG3 -ON and MEG3 -OFF human embryonic stem cells (hESCs) by detecting the expression of the DLK1-DIO3 locus-derived non-coding RNAs (ncRNAs). (A) The DLK1-DIO3 imprinted locus, which is highly conserved between mice and humans, including clusters of maternally expressed functional ncRNAs, which are marked in red. The human homologs of the Gtl2 and Rian mice genes are MEG3 and MEG8 , respectively. Lollipops with closed circles represent methylated CpG regions, and open circles represent unmethylated CpG regions. Mat, maternal chromosome; Pat, paternal chromosome. (B) The hESCs with high expression levels of imprinted long non-coding RNAs (lncRNAs) ( MEG3 and MEG8 ) and of several imprinted microRNAs (miRNAs) from the DLK1-DIO3 locus (miR-127-3p, miR-154, miR-376c, miR-495, miR-494, and miR-496) were classified as MEG3 -ON hESCs. The hESCs without detectable MEG3 expression accompanied by significant repression of other ncRNAs from the same locus were classified as MEG3 -OFF hESCs. GAPDH was used as an internal control for mRNA expression analysis, and RNU48 was used as an internal control for miRNA expression analysis. The quantitation of lncRNA and miRNA expression was performed by using the 2 −ΔΔCp method. Error bars represent the standard error of the mean generated from three biological repeats. ** P <0.01 with respective MEG3 -ON groups by Student’s t test. DLK1-DIO3 , delta-like homolog 1 gene and the type III iodothyronine deiodinase gene; Gtl2 , gene trap locus 2; IG-DMR, intergenic differentially methylated region; MEG3 , maternally expressed gene 3; N.D., not detectable.

Article Snippet: The MEG3 -siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNA-GFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNA-GFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3 -shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021).

Techniques: Expressing, Derivative Assay, Functional Assay, Methylation, Quantitation Assay, Generated

Journal: Stem Cell Research & Therapy

Article Title: Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines

doi: 10.1186/scrt535

Figure Lengend Snippet: Twelve - day-old embryoid bodies (EBs) differentiated from MEG3 -OFF human embryonic stem cells (hESCs) displayed abnormal morphologies and expression levels of developmentally regulated genes. (A) Day 12 EBs that were differentiated from MEG3 -OFF NTU1 hESCs were smaller and not well bordered in structure than EBs differentiated from MEG3 -ON NTU1 hESCs. Scale bars, 1,000 μm. The bar chart illustrated the differences in diameters of the 12-day-old EBs derived from MEG3 -ON and MEG3 -OFF hESC sublines. Error bars represent the standard error of the mean (SEM) generated from three biological samples with 20 to 40 EBs in each group. ** P <0.01 with respective MEG3 -ON groups by Student’s t test . (B) Day 12 EBs differentiated from MEG3 -OFF hESCs displayed unusual expression levels of developmentally regulated genes, including higher expression levels of endoderm- and mesoderm-related genes ( SOX17 and HAND1 , respectively) and low but detectable expression levels of an ectoderm-related gene ( PAX6 ). ‘d’ represents the day of EB formation. GAPDH was used as an internal control for mRNA expression analysis. The quantitation of mRNA expression was performed by using the 2 −ΔΔCp method. Error bars represent the SEM generated from three biological samples with three technical repeats each. ** P <0.01 compared with the corresponding MEG3 -ON groups by Student’s t test. MEG3 , maternally expressed gene 3.

Article Snippet: The MEG3 -siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNA-GFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNA-GFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3 -shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021).

Techniques: Expressing, Derivative Assay, Generated, Quantitation Assay

Journal: Stem Cell Research & Therapy

Article Title: Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines

doi: 10.1186/scrt535

Figure Lengend Snippet: MEG3 -OFF human embryonic stem cells (hESCs) displayed different transcriptome profiles, particularly in genes related to neural lineage. (A) In total, 114 genes displayed significant differential expression between MEG3 -ON and MEG3 -OFF hESCs. The embryoid body (EB) sample differentiated from ‘ MEG3 -ON’ hESCs was used as a reference for differentiated hESCs. The heatmap represents the most significant differentially expressed genes selected by the intersection indicated by Welch’s t test ( P <0.05; fold change >1.5) and significance analysis of microarrays (SAM) (false discovery rate <0.05). The heatmap displays differentially expressed genes that can be used to distinguish between the MEG3 -ON and MEG3 -OFF cell states. The green-to-red colors of the heatmap are linearly mapped to the Z-scores, which range from −3 to 3. (B) MEG3 -ON and MEG3 -OFF hESCs showed differences in the expression levels of many genes that correlate with neural lineage development and with different tumor types. This analysis was performed by using MetaCore software (GeneGo), which includes developmental processes 1,317 Gene Ontology (GO) terms in Biological Process for GO process testing and literature-based biomarkers of clinical diseases for GO disease testing. (C) A partial gene list of subset of genes related to ‘nervous system development (GO:0007399)’ was clearly shown to be differentially expressed between undifferentiated MEG3 -ON and MEG3 -OFF hESCs by using GSEA. In this heatmap, expression values are represented as colors, with the range of colors (red, pink, light blue, and dark blue) indicating the range of expression values (high, moderate, low, and lowest, respectively). MEG3 , maternally expressed gene 3.

Article Snippet: The MEG3 -siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNA-GFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNA-GFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3 -shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021).

Techniques: Expressing, Software

Journal: Stem Cell Research & Therapy

Article Title: Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines

doi: 10.1186/scrt535

Figure Lengend Snippet: Associations between the expression of MEG3 and neural lineage genes in human embryonic stem cell (hESC) and human induced pluripotent stem cell (hiPSC) lines. (A) Repression of MEG3 was consistently correlated with downregulation of PAX6 , RTN1 , and DLK1 in various cell lines. The cell lines where MEG3 was not detectable, including NTU1, NTU3, H9, and iPSC lines, also displayed lower expression levels of PAX6 , RTN1 , and DLK1 . The mRNA expression was quantified with the 2 −ΔΔCp method (using GAPDH for normalization). In the NTU1 and NTU3 hESC lines, error bars represent the standard error of the mean (SEM) generated from three biological repeats. In the H9 hESC line and the two iPSC lines, error bars represent the SEM generated from one biological sample with three technical repeats. * P <0.05, ** P <0.01 with the corresponding MEG3 -ON groups by Student’s t test . N.D., not detectable. (B) MEG3 knockdown assays were conducted via small hairpin RNA (shRNA) and small interfering RNA (siRNA) to examine the association between MEG3 reduction and the expression levels of neural lineage-related genes in NTU1 hESCs. In the sh- MEG3 group with MEG3 reduction, PAX6 , RTN1 , and DLK1 showed downregulated expression (upper panel) compared with the scramble control. PAX6 and RTN1 were also downregulated in two si- MEG3 -treated groups with reduced MEG3 expression, whereas DLK1 was reduced in one siRNA-treated group compared with the scramble control (lower panel). The mRNA expression was quantified with the 2 −ΔΔCp method (using GAPDH for normalization). Error bars represent the SEM generated from one biological sample with three technical repeats each. * P <0.05, ** P <0.01 with the corresponding scramble control groups by Student’s t test in shRNA experiments; one-way analysis of variance and Dunnett’s multiple comparisons test were used in siRNA experiments, with significance defined as * P <0.05 and ** P <0.01. MEG3 , maternally expressed gene 3.

Article Snippet: The MEG3 -siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNA-GFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNA-GFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3 -shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021).

Techniques: Expressing, Generated, shRNA, Small Interfering RNA

Journal: Stem Cell Research & Therapy

Article Title: Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines

doi: 10.1186/scrt535

Figure Lengend Snippet: Neural markers were differentially expressed between MEG3 -ON and MEG3 -OFF human embryonic stem cell (hESC)-differentiated cells during neural lineage differentiation. (A) Neural lineage differentiation was conducted from the undifferentiated stage to the 18 day-Matrigel attachment stage in NTU1 and NTU3 hESC lines. (B) Expression levels of stage-specific markers were analyzed by quantitative reverse transcription-polymerase chain reaction in MEG3 -ON and MEG3 -OFF groups during differentiation. The quantitation of mRNA expression was performed by using the 2 −ΔΔCp method (using the housekeeping gene GAPDH for normalization). Error bars represent the standard error of the mean generated from three biological samples with three technical repeats each. * P <0.05, ** P <0.01 compared with the respective MEG3 -ON groups by Student’s t test. MEG3 , maternally expressed gene 3; NES, neuroectodermal sphere.

Article Snippet: The MEG3 -siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNA-GFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNA-GFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3 -shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021).

Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Quantitation Assay, Generated

Journal: Stem Cell Research & Therapy

Article Title: Loss of non-coding RNA expression from the DLK1-DIO3 imprinted locus correlates with reduced neural differentiation potential in human embryonic stem cell lines

doi: 10.1186/scrt535

Figure Lengend Snippet: Neurite formation was reduced in MEG3 -OFF human embryonic stem cell (hESC)-differentiated cells compared with cells differentiated from MEG3 -ON hESCs. Immunofluorescent staining was performed with anti-beta-III Tubulin and anti-MAP2 antibodies to examine neurite formation in cells derived from MEG3 -ON and MEG3 -OFF hESCs of the NTU1 (A) and NTU3 (B) cell lines after 18 days of differentiation on Matrigel. Scale bars, 100 μm. MEG3 , maternally expressed gene 3.

Article Snippet: The MEG3 -siRNA plasmids and their target sequences for MEG3 are as follows: MEG3-451 siRNA-GFP: tgtgttcacctgctagcaaactggagtgt; MEG3-512-siRNA-GFP: actgactctgtcatcacccttatgatgtc. (ii) MEG3 -shRNA plasmid with the other target sequence and the scrambled shRNA plasmid (OriGene TR30021).

Techniques: Staining, Derivative Assay